Real Players of the Department of Life
Chapter 49 Research
Chapter 49 Research
Of course Zhang Cishun knew what a qualified person was, but he was not sure whether Ning Jiancheng knew.So he didn't say anything.
Wenquan slowly explained the information about the qualified candidates to Zhang Cishun. While explaining, he also manipulated the map on the image to enlarge and peel it off.
"This is a genetic sequence in the body of a qualified person. If you have learned this knowledge, you should be able to understand it." Wenquan said, turning to look at Zhang Cishun.
Zhang Cishun noticed Hot Spring's gaze, but did not turn his head to meet her gaze. The genetic engineering of lv2 and the biological skills of lv4 allow him to understand the information in this map, but they are not enough to support him to expand based on the 'knowledge' he has learned.
But unfortunately, Zhang Cishun once read the document named "Gene Map of Qualified Persons" in the USB flash drive brought back by Zuo Yan.
There are some differences between the content of the data and the map in front of you, but genetic engineering and biological technology are fully capable of building a bridge called 'integration'.
The laboratory was quiet for a while under the pause of the hot spring's words. It wasn't until the eyes of other personnel in the room turned to him that Zhang Cishun sorted out his words in his mind:
"This gene is called ABCD1, or you can call it ALDP. The chromosome location is located at 12q25, the base sequence is ATCGATCGAATTGCCAGCTG, and the promoter region is TATAAAACTGAGTA. Normally the length of the complete encoded protein should be 740, but what you show here It's abnormal. There are...a hundred more than normal.
Considering that this is the genetic map of a qualified person, these one hundred abnormally encoded proteins should be the target.
If we do not consider the extra [-] encoded proteins under normal circumstances, they are highly expressed in liver, kidney, brain and muscle tissue, with a mutation frequency of one in [-], often manifesting as missense mutations. Sense mutations and indels, etc. "
Zhang Cishun narrated this passage clearly. After finishing speaking, he looked back at the others: "So what kind of mutation is this?"
As Zhang Cishun finished his obviously questioning words, he noticed that the two researchers standing opposite withdrew their gaze.
After Wenquan raised his hand and gave him a thumbs up, he said: "It is not classified as a mutation for the time being. Under normal circumstances, mutations in this section of the genome will manifest as myelin loss, adrenal gland dysfunction, nervous system degeneration and many other symptoms, but With the participation of the extra one hundred coding proteins...all negative mutations have become positive. This can be regarded as optimization, or...evolution."
"Understood." Zhang Cishun nodded.
"So what do I need to do?"
……
Time passed quickly during the experiment, but there was actually little progress in the experimental research content.Zhang Cishun's main job today is to be an assistant and not participate in front-line operations.
Zhang Cishun was also happy with this.
after the end
Zhang Cishun followed the four people in the hot spring to the locker room.
When everyone changed their dark green 'surgical clothes' into their previous white research clothes, he noticed that among the five people present, excluding himself, two of the logos behind the four people were INNHBS (Neural Network and Human Brain) Simulation Research Institute), and two are CCGE (Center for Cloning and Genetic Improvement).
In the same research institute as Zhang Cishun, there are two girls including Hot Spring, and the two boys are from CCGE.
There is a window in the locker room, and it was supposed to be able to see the outside scenery from here, but because of the sandstorm, what I can see now is only black.
When the warm light of the dressing room shines through the window, traces of the wind and sand can still be clearly seen.
While Zhang Cishun was looking at the sandstorm outside the window, two CCGE people came over.
"Get to know me, my name is Yang Sheng."
"Liu Yiwei."
Zhang Cishun turned his head, pushed up his glasses, and said, "Ning Jiancheng."
None of the three intends to shake hands.Yang grew up with sharp edges and corners. Compared with Yang Sheng, Liu Yiwei was a head shorter and much fatter.
In this world, being able to gain weight is a very happy thing.
Liu Yiwei is probably the first fat man Zhang Cishun has seen in a real sense since he came to this world.
"Are you not unhappy just now?" Yang Sheng asked, then reached into his pocket and took out a sky blue cigarette case.
After opening it, it must be passed to Zhang Cishun.
"Unhappy... When do you mean?" Zhang Cishun asked.
Yang Sheng's cigarettes were accepted, because Ning Jiancheng is a smoker.
"When Wenquan asked you about ALDP." Yang Sheng explained: "That question was considered a simple test. Wenquan had no intention of doing this. It was the two of us who thought it was necessary to test your level. Before you came, we and Wenquan I keep talking about this."
Yang Sheng started lighting the fire as he spoke. When he handed the fire to Zhang Cishun, Zhang Cishun pushed his hand and refused.
Yang Sheng didn't care. After lighting it for himself, he continued: "Our research group is almost ready to produce results. The previous Lao Zhang and several others were transferred away by the superiors, and our group almost stopped. But although There is a shortage of people, but we don’t want anyone to be able to come in.
Originally, this was an internal matter within the INN. If someone came in for a smooth transfer or something like that, the two of us were actually not prepared to say anything, but... you are from Zhongcheng District. "
Although both are research institutes, there are still differences between Midtown and Uptown.
Different pools have different ingredients.
Zhang Cishun thought for a while and asked, "Then I have passed your assessment now?"
Yang Sheng said: "For now."
Zhang Cishun thought this person was quite interesting, with a blatant hostility, but no malice.It can be seen that Yang Sheng's hostility towards him is only because he is from Midtown, and he is worried that his level is not enough, which will hinder the entire research team.
Zhang Cishun didn't pay much attention to the matter of the assessment. He has almost figured out the progress of the research of this group. If he only uses his own "knowledge" to advance the research, he may not be as good as that, but it's still the same sentence. In other words, Zuo Yan's document was of great use.
Perhaps this document cannot help him advance his research, but it should be no problem to cope with the so-called Yang Sheng's assessment.
After talking about this topic, the three of them chatted briefly and then dispersed.
Neither Yang Sheng nor Liu Yiwei are eloquent people.They only talk at length when it comes to their area of expertise, but otherwise...
Zhang Cishun did not leave with the two of them, but waited until they left, then reached out and handed the cigarette that Yang Sheng had given him to an empty place beside him.
After a few breaths, the smoke disappeared in his hand.
……
(End of this chapter)
Of course Zhang Cishun knew what a qualified person was, but he was not sure whether Ning Jiancheng knew.So he didn't say anything.
Wenquan slowly explained the information about the qualified candidates to Zhang Cishun. While explaining, he also manipulated the map on the image to enlarge and peel it off.
"This is a genetic sequence in the body of a qualified person. If you have learned this knowledge, you should be able to understand it." Wenquan said, turning to look at Zhang Cishun.
Zhang Cishun noticed Hot Spring's gaze, but did not turn his head to meet her gaze. The genetic engineering of lv2 and the biological skills of lv4 allow him to understand the information in this map, but they are not enough to support him to expand based on the 'knowledge' he has learned.
But unfortunately, Zhang Cishun once read the document named "Gene Map of Qualified Persons" in the USB flash drive brought back by Zuo Yan.
There are some differences between the content of the data and the map in front of you, but genetic engineering and biological technology are fully capable of building a bridge called 'integration'.
The laboratory was quiet for a while under the pause of the hot spring's words. It wasn't until the eyes of other personnel in the room turned to him that Zhang Cishun sorted out his words in his mind:
"This gene is called ABCD1, or you can call it ALDP. The chromosome location is located at 12q25, the base sequence is ATCGATCGAATTGCCAGCTG, and the promoter region is TATAAAACTGAGTA. Normally the length of the complete encoded protein should be 740, but what you show here It's abnormal. There are...a hundred more than normal.
Considering that this is the genetic map of a qualified person, these one hundred abnormally encoded proteins should be the target.
If we do not consider the extra [-] encoded proteins under normal circumstances, they are highly expressed in liver, kidney, brain and muscle tissue, with a mutation frequency of one in [-], often manifesting as missense mutations. Sense mutations and indels, etc. "
Zhang Cishun narrated this passage clearly. After finishing speaking, he looked back at the others: "So what kind of mutation is this?"
As Zhang Cishun finished his obviously questioning words, he noticed that the two researchers standing opposite withdrew their gaze.
After Wenquan raised his hand and gave him a thumbs up, he said: "It is not classified as a mutation for the time being. Under normal circumstances, mutations in this section of the genome will manifest as myelin loss, adrenal gland dysfunction, nervous system degeneration and many other symptoms, but With the participation of the extra one hundred coding proteins...all negative mutations have become positive. This can be regarded as optimization, or...evolution."
"Understood." Zhang Cishun nodded.
"So what do I need to do?"
……
Time passed quickly during the experiment, but there was actually little progress in the experimental research content.Zhang Cishun's main job today is to be an assistant and not participate in front-line operations.
Zhang Cishun was also happy with this.
after the end
Zhang Cishun followed the four people in the hot spring to the locker room.
When everyone changed their dark green 'surgical clothes' into their previous white research clothes, he noticed that among the five people present, excluding himself, two of the logos behind the four people were INNHBS (Neural Network and Human Brain) Simulation Research Institute), and two are CCGE (Center for Cloning and Genetic Improvement).
In the same research institute as Zhang Cishun, there are two girls including Hot Spring, and the two boys are from CCGE.
There is a window in the locker room, and it was supposed to be able to see the outside scenery from here, but because of the sandstorm, what I can see now is only black.
When the warm light of the dressing room shines through the window, traces of the wind and sand can still be clearly seen.
While Zhang Cishun was looking at the sandstorm outside the window, two CCGE people came over.
"Get to know me, my name is Yang Sheng."
"Liu Yiwei."
Zhang Cishun turned his head, pushed up his glasses, and said, "Ning Jiancheng."
None of the three intends to shake hands.Yang grew up with sharp edges and corners. Compared with Yang Sheng, Liu Yiwei was a head shorter and much fatter.
In this world, being able to gain weight is a very happy thing.
Liu Yiwei is probably the first fat man Zhang Cishun has seen in a real sense since he came to this world.
"Are you not unhappy just now?" Yang Sheng asked, then reached into his pocket and took out a sky blue cigarette case.
After opening it, it must be passed to Zhang Cishun.
"Unhappy... When do you mean?" Zhang Cishun asked.
Yang Sheng's cigarettes were accepted, because Ning Jiancheng is a smoker.
"When Wenquan asked you about ALDP." Yang Sheng explained: "That question was considered a simple test. Wenquan had no intention of doing this. It was the two of us who thought it was necessary to test your level. Before you came, we and Wenquan I keep talking about this."
Yang Sheng started lighting the fire as he spoke. When he handed the fire to Zhang Cishun, Zhang Cishun pushed his hand and refused.
Yang Sheng didn't care. After lighting it for himself, he continued: "Our research group is almost ready to produce results. The previous Lao Zhang and several others were transferred away by the superiors, and our group almost stopped. But although There is a shortage of people, but we don’t want anyone to be able to come in.
Originally, this was an internal matter within the INN. If someone came in for a smooth transfer or something like that, the two of us were actually not prepared to say anything, but... you are from Zhongcheng District. "
Although both are research institutes, there are still differences between Midtown and Uptown.
Different pools have different ingredients.
Zhang Cishun thought for a while and asked, "Then I have passed your assessment now?"
Yang Sheng said: "For now."
Zhang Cishun thought this person was quite interesting, with a blatant hostility, but no malice.It can be seen that Yang Sheng's hostility towards him is only because he is from Midtown, and he is worried that his level is not enough, which will hinder the entire research team.
Zhang Cishun didn't pay much attention to the matter of the assessment. He has almost figured out the progress of the research of this group. If he only uses his own "knowledge" to advance the research, he may not be as good as that, but it's still the same sentence. In other words, Zuo Yan's document was of great use.
Perhaps this document cannot help him advance his research, but it should be no problem to cope with the so-called Yang Sheng's assessment.
After talking about this topic, the three of them chatted briefly and then dispersed.
Neither Yang Sheng nor Liu Yiwei are eloquent people.They only talk at length when it comes to their area of expertise, but otherwise...
Zhang Cishun did not leave with the two of them, but waited until they left, then reached out and handed the cigarette that Yang Sheng had given him to an empty place beside him.
After a few breaths, the smoke disappeared in his hand.
……
(End of this chapter)
You'll Also Like
-
Revisit Azur Lane
Chapter 174 9 hours ago -
Crossover Anime: The Heroine's Savior in the Other World
Chapter 149 9 hours ago -
[Genshin Impact]: I can become stronger by cooking.
Chapter 172 9 hours ago -
Poseidon in Arknights
Chapter 226 9 hours ago -
People at the practical education center only want to drop out.
Chapter 221 9 hours ago -
Hong Kong variety show: My Boss, Thirteen Sister
Chapter 145 9 hours ago -
Born Saints: Starting from Liaozhai
Chapter 66 9 hours ago -
I only wanted to retire, but I ended up becoming an extremely popular character.
Chapter 72 9 hours ago -
The maze was built starting with the mother skeleton replenishing its magic.
Chapter 64 9 hours ago -
America: The Cremator
Chapter 91 9 hours ago