Mushoku no Eiyuu ~Betsu ni Skill Nanka Iranakattan daga~
Episode 29: It's I Learned
"What is it ?!" Sword Princess "Fara is actually a" Sword God! "And how can Allel use that skill ...?"
"Everything is just the same."
What I learned over the last five years is not just Sword Princess skill.
He had the skill of Sword God at the same time.
Rather, it can be said that most of the time was spent on the latter.
The sword princess skill became a little better in a year, but the sword god skill took nearly four more years to master.
At that time, the pressure felt by the golden living armor suddenly increased.
It seems that you were pressured by that alone, and you fall into the place as if you were a young man.
"It looks like they're really serious."
Sword God skill
It is a substandard technique that temporarily increases one's physical ability several times.
Sword God is unrivaled in all abilities, including strength, agility, and dexterity, but is further enhanced by this boost, giving it the strength as if God had descended.
"But that's what I've learned too."
I also respond with God Possession.
Those who entered the realm of God clashed, and the shock alone caused a terrible storm.
Zugagagagagagagagagagagagagagagagagaga! !
The roaring sword sound is like a ground noise.
"Well, what is this !? It's not such a human battle! It's almost a natural disaster!"
"Is this" god possession "...?!?"
"Either way, anyway, there's nothing else that Allele of" Unemployed "can use up to the skill of" Sword God "!?"
Lilia and Lina are shouting as they are about to be blown away by the wind.
Not everything.
Sword God's skill is even more straining on the body than Sword Princess.
This is especially true of God.
After all, they are forcibly extracting the power that should have been saved unconsciously in consideration of the burden on the body.
Just keeping this state will reduce the pounding protection.
However, thanks to muscle training or {strong} training, it's much better than before.
"... but there's no tired thing in front of him."
Living armor is solid armor.
Therefore, muscles do not become tired or lose physical strength like humans.
Unless you destroy armor like an exoskeleton, you will probably be able to use God Possession forever.
In short, it must be decided early but-
Living Armor moved first because he hated the stalemate.
This is ... Sword God's special skill
A continuous fire that lasts semi-permanently until the opponent dies.
Moreover, the strokes are so perfectly interlocked that if you eat the first shot, you will no longer be able to escape or even fall down.
"But that is bad."
Rather, I hate the stalemate.
If there was no shortage of stamina, it would have been better to keep the slashes at the same level.
I knew that I could acquire the skills of a swordsman even if I was unemployed, so I volunteered for my mother to become a disciple.
Even so, teaching sword skills to people who do not have the skills is extremely difficult.
First of all, my mother is not smart enough to teach people something.
So basically, I just saw and learned the skills that my mother showed me. Of course, it was impossible to reproduce the skills just by looking at them.
Therefore, I thoroughly analyzed the skill.
I fully understood everything, including posture, breathing, eye movements, and sword trajectory.
Therefore, the () technique () of this () is () effective () or () () for () me ().
I determined the moment of the trick, and crush it instantly.
The first shot that hit him exquisitely disrupted his balance and canceled the skill.
[That! ?
The heartless golden living armor seemed astonished.
"Return"
Living armor that prevents special skills and is slightly rigid.
Do not miss the momentary gap.
It's no wonder that I've always been aiming for the moment where I can hit the deadly skills from here.
I released {Infinite Break}.
The whole armor was slammed on the ground with a loud noise.
No, it's no longer a full body armor.
The arms are both cut and rolled, and the legs are bent in other directions.
The helmet is shady and has no shadow to look at, and the trunk is barely connected around the waist.
The golden armor has now turned into clumps of junk.
"... I'm really tired."
For convenience, fifty-eight.
The number of slashes you've made before destroying the golden armor.
I think that forty shots were enough, but I was careful to destroy them.
Because they move with magic, they can continue fighting normally if their arms are cut off or their helmets are destroyed.
I tried to hit it with a sword, but it seemed to have completely stopped functioning.
"Oh, did you save ...?"
The young man who put us in the trap is muttering stunned.
"I'm the only enemy to come out."
"Don't tell me no scary !?"
You'll Also Like
-
Do you like humans that much, Chihaya Aine?
Chapter 115 14 hours ago -
God-level chat group
Chapter 803 14 hours ago -
After leaving the world of all NPCs
Chapter 352 14 hours ago -
What did you do with the dice?
Chapter 376 14 hours ago -
Soman Shuchiin, starting from Fulilian to become a magician
Chapter 85 14 hours ago -
Anime cuisine: Starting with glowing dishes
Chapter 183 14 hours ago -
Dragon Ball: Xidu High School students captured No. 18!
Chapter 160 14 hours ago -
I only have one year to live, so I must become a legendary horse girl!
Chapter 230 14 hours ago -
Zongman: Don't move, Aisi, your family still owes me money
Chapter 145 14 hours ago -
Taking stock of the knights in the parallel world, all the members of Chuangqi go to sea
Chapter 436 14 hours ago