Raid Breaker
< [Chapter 88] Soul Chain (1) >
@ Soul chain
Darhk failed to trigger the Shadow Prison at the timing he wanted, but at least keeping Crowe in the Shadow Prison succeeded. Perhaps Crowe also used pretending to be dead to withstand the aftermath of the apocalypse, so it was hard to react quickly.
Shadow Prison was the most powerful attack technique available to Dark. Of course, Darhk used this mostly on weakened opponents, but at least now he has no choice but to use it on a prowling opponent.
However, Darhk considers his "Shadow Prison" to be quite feasible, even if his opponent's condition is normal.
The Dark Shadow Prison was comprised of three abilities: The "Shadow sickle" and "Shadow Shield", which are the three types of attacks and defenses, could be used without activating the Shadow Prison, but their power was slightly reduced.
In fact, shadow sickles and shadow shields required a third ability, 'Shadow Fog’, to exert true power. The power to twist Crowe and Dark's body at the same time and make the world a perfect darkness...... This was the shadow fog.
To distinguish the Shadow World from its kind of technology, it is a buff and debuff technique for the dark self.
At least Darhk was confident that no one would stand against him in the Shadow Prison. He even thought it was worth confronting the "transcendent" who was recorded as something that should never be touched with his living information.
Of course, the transcendent was definitely Dark's ‘arrogance,' but that meant that he was feeling confident about the Shadow Prison.
That's why Darhk believed that the moment Crowe was perfectly caught in the Shadow Prison, he could avenge a few surprises.
Finally.
In Shadow Prison, "Shadow Fog" was shaking, and the fog soon caught up with Crowe and interrupted Crowe's movements. It was as if sticky liquid was pouring down from all over and wrapping around the body.
Of course, the movement was slow and, at the same time, corrosion began to occur throughout the armour.
The armor doesn't melt right away, but even if you're stuck here for at least half an hour, it all melts and feels like it's gone.
‘Jan, give me a status report. ’
- The slowing effect is about 30 percent, and corrosive materials are causing the external gloves to completely disappear in exactly 28 minutes.
‘Damn……. ’
Soohyuk realizes that he simply used to pretend to be dead too easily to avoid the aftermath of the explosion.
Dark's Shadow Prison was a much more powerful ability than I expected, and Soohyuk, who was perfectly caught up in it, had no choice but to frown.
Tsuztsk!
But what was even worse was that a big black sickle appeared in front of Crowe again. The black sickle was an attack Suhyuk had already experienced. At least in Suhyuk's experience, it seemed almost impossible to avoid or prevent the black sickle in its current state.
‘At this rate we will be defeated. ’
The Dark Shadow Prison threatens Suhyuk even more than I thought. And the threat soon became a threat.
Shhh! Guaguava overload!
Once the Shadow Scythe swings, the space that Crowe was standing in splits apart. Soohyuk quickly escaped from the dividing place of the Shadow Movement, but unfortunately, he was unable to escape the Shadow Prison through the Shadow Movement.
Shadow Prison was not merely a concept of space, but a concept of target, so of course, it was not possible to move space and escape Shadow Prison.
"Shit, it's faster and more powerful than last time, right? ’
Soohyuk realized at once that the black sickle is more powerful than the black sickle that shattered the seven demolitions. It meant that if the black sickle was swung again, it could not be avoided or stopped this time.
There was only one thing Su-hyuk could do in this situation where everything was going to the worst.
Unseal! The Power of the Transcendent Azura!! ’
Soohyuk took out the last thing he could do under the worst circumstances.
The transcendent beast!
This was the best hand Suhyuk could pull out, and the final hand. Using this meant I would finish everything in a minute.
Winning or not, the battle was inevitable within a minute.
Goooooooooo.
The moment when Crowe's body was leaned by the strength of oil that protruded from an unknown space. A cane of voice is heard in Suhyuk's brain on board the Crow.
"If you want my power... I'll give it to you!" ’
Quadruple!
Soohyuk was able to get rid of the sticky energy that was wrapped around his body so easily the moment Azura's power possessed Crow.
Damn it, Guava!
Not only that, you swing the sickle towards yourself, swinging the daemon slayer lightly. Without the power of Asura, it would have been impossible, but I was able to defeat the Shadow sickle as much as I could with the power of Asura now.
The situation changed in a single moment. Successful imprisonment in Shadow Prison, Darhk thought all he had to do was quietly subdue the opponent and turn him into his own.
However, the opponent who was completely wrapped up in the ‘Shadow Fog’, which was full of Shadow Prison... … tore the Shadow Fog wrapped around his body by force, but also blocked the Shadow Fog in front of him.
Obviously, it seemed like a lot to avoid until just now, but all of a sudden, everything changed.
The energy that flowed from Crowe's body was passed on to the Dark, and through it he felt a darkness of despair that could not be deepened.
‘Above, dangerous. ’
The Dark Energy emanating from Crowe's body was greater and more powerful than the Dark Energy of Darkness. The Dark Energy makes it so easy for a strong man to devour a weak one by nature.
That's why Darhk thought he'd rather be eaten by the opposition.
Profit!
Of course, the dark man, who could not sit idly, inflated himself as much as he could, pulled out his Shadow sickle and Shadow Shield simultaneously.
In the present situation, Darhk lunges at Crow, rushing towards himself after pulling all his strength because he had to eat the other way around.
Blah, blah, blah! Blah, blah, blah, blah!
With the power of Asura, Crowe and all the Shadow, the Darkness clashes in the air and makes a sound.
Whether Azura with the Darkness of Despair will be strong, or the Darkness that has been scraped from the shadows will be stronger than the Darkness…… I can only tell with the right result.
Every time a shadow sickle or shield hits the daemon slayer, the dungeon shakes like a collapse. No, actually, there was a crack in the Shadow Prison.
It meant that one collision was emitting enormous destructive energy.
Because they were both the same dark force, the resonance of the force became more intense, resulting in a unilateral loss.
The winner and the loser have to be extremely divided in the situation....
It was Asura with a darkness of despair that draws all the darkness in the world. Precisely Suhyuk, who unleashed the power of Asura, pushes Darhk with all his strength into the daemon slayer without cause.
There is only 20 seconds left...
If we couldn't connect this victory to victory within 20 seconds, Soohyuk had to be eaten.
Quasiguaguaguaguaguaguagua!
Suhyuk smashes his Shadow sickle and shield, swinging the daemon slayer with all his might. Then, without hesitation, he began to dismember the Dark Body.
Raaaarrgh! Finally!
About five minutes ago, Darhk's body, which had disappeared by about 20% due to a catastrophic explosion, began disappearing without cause, thanks to the power of Asura.
Tsk, tsk!
Every time the daemon slayer sweeps through the body, the shadows that the dark collected for many years flew away by at least 5% .7%, 6%, 9%, 5% …….
The body of the dark that keeps disappearing.
Darhk wanted to prevent or avoid this attack in any way, but he was already completely caught in the darkness of despair and couldn't escape.
"Oh no!!! ’
Darhk struggles as hard as he can, trying to hold on. Despite Darhk's struggle, however, Crow's swinging daemon slayer quickly dismembers the dark body and pulls the dark into despair.
However...... there was also a problem with Soohyuk who was in a good mood. It was that the fall of Azura was over in just seven seconds.
Once the power of Azura is gone, Crowe is likely to be almost unusable immediately. Then, even if Soohyuk had God now, things could have turned upside down again at once.
Of course, if I could finish perfectly in 7 seconds, it wouldn't be a problem. But it didn't look like I could finish in seven seconds.
‘Not like this. ’
Just as Dark felt desperate, Soohyuk felt desperate too. It was ironic that we were faced with the opposite situation and felt the same desperation, but both of us tried to resolve this desperation right away.
Dark's choice was to flee.
He plans to leave everything behind and escape with only the most important Shadow Core. This way, all the ball towers that had been piled up had to collapse.
It was hard to predict exactly, but Darhk had to weaken to the level of a grade 4 monster. It was as painful as real death to fall from a grade 9 monster close to transcendence to a common grade 4 monster, but it was much better than disappearing and fading away.
Critically, Darhk was confident that he would rebuild the tower and return to his current state. So he dared to flee.
Paaaaaaaah!
Dark, eager to abandon his body and quickly escape the Shadow Prison. But this choice of Darkness gave Su-hyuk a chance.
Suhyuk, who was feeling as desperate as the Darkness, focused his whole mind on finding a way to defeat the Darkness. The concentration of Suhyuk was similar to that of Gene Kronos in the past, as it had come to Asura.
Is that why?
Soohyuk captured the attempt to escape from the Darkness with great precision.
You only have three seconds left.
Soohyuk can't finish the dark for a moment, but he can think of a way to finish it with the level of finishing he gave him.
I got you!
Papa-pot!
Soohyuk charged forward using a series of Shadow Movements towards the escaping dark, while summoning a large door in front of him.
At that moment, Crowe catches up with Darhk, who abandons almost everything and tries to infiltrate the Shadow. Then... I was dragged by Crowe and dragged inside the big door in front of me.
Quack, quack, quack!
As Crowe smashes through the door, Asura's power disappears. It was a big difference. Even if it was only about 0.01 seconds late, it was most likely a failure to bring in the dark.
It must have been unfair for the Dark, but it was Soohyuk who was able to smile until the end.
Dark and Soohyuk were both equally desperate, but eventually, the first to move was hit by a counter by Soohyuk who later moved.
“Rrrrgh!”
A dark, loud roar that stretches its arms to the outside of the door.
However, his body had already passed through the door and was immersed in the four-dimensional space of the 'Door and Room’, which is the only space of succession.
< [Chapter 88] Soul Chain (1) > End
Seongjin
You'll Also Like
-
Ghost Knight King's Dungeon Project
Chapter 92 1 days ago -
Peerless Tang Sect: Becoming a God Through Medicine
Chapter 151 1 days ago -
Naruto: I'm in Konoha, my name is Uzumaki Menma
Chapter 349 1 days ago -
My profession is too unique.
Chapter 173 1 days ago -
Grass and mustard reign supreme
Chapter 155 1 days ago -
Starting Immortal Cultivation from a White Dog
Chapter 261 1 days ago -
Reborn Before the Apocalypse: My Backing is the Nation
Chapter 219 3 days ago -
Cornflower Witch
Chapter 286 3 days ago -
Hogwarts Study Panel
Chapter 404 3 days ago -
Speed God
Chapter 177 3 days ago