The Baby Raising A Devil
117 Hrs
I swiftly pushed Ishaq, who was looking at me.
Bang!!
"What?!"
Surprised by the noise, people looked around.
"Thunder?"
"Nonsense. What a thunder it is when it doesn't rain."
Families found a terrific origin, but they didn't see anything.
I stared at the man in the air.
'What, that's weird.'
The man's eyebrows twitched. It's as if you understand me.
At that moment, I recalled the summoning faction I saw in the secret warehouse of Balua.
"No way. '
[Who dares to look into the minds of foolish creatures!]
A thunderous shout echoed through his head.
I knew it!
I bit my lips tightly.
It must be Baluana or her family that the Devil is here to summon the Devil.
Families are unaware of the devil. Even if you are aware of it, you will not be able to fight the devil.
Which means I have to keep it.
'But you can't use magic.'
It is forbidden to use magic within the Imperial Palace without the permission of the Emperor.
If this happens, I can't do it.
I grabbed the blind spot in my arms.
and shed a very small amount of divine power.
By the way.
Why aren't you responding? '
I shook a panic blind spot.
It re-energized the divine power, but there was still no response.
Is this not a passageway? '
But I definitely felt the same sensation as Bune and Pymon's passage when I touched the blind spot before the meal.
Besides, if this is a regular jewel, there is no reason why the Temple has been agitated to recruit holy knights secretly.
The spark once again came from the hand of the demon in the air.
The Devil's gaze was on him.
"No!"
I screamed and stood in my father's way.
Something like the Devil's Fire came to mind before the starter came into my hands.
Quaguaguaguaguaguaguaguagua Cave!!
I encountered the shield I unfolded and the power of the devil.
"LeBlaine!"
Auntie came running surprised.
"What are you doing? Hurry and reap the shield! Magic in the Imperial Palace...!"
"Don't step forward!"
"What?"
"Stay back, please!"
I thought the shield would be broken even soon. I feel like my whole body is breaking.
I knew the moment the demon's power collided with my shield.
I know I'll never win that demon.
Bang!!!
"Evil!"
When I couldn't beat the difference in power, the family flew back and said, "LeBlaine!!" I came running screaming.
I groaned and curled. I tried to get up quickly, but I don't know if I hit my leg properly. I grabbed the communication stone in my pocket.
"What the hell.... kid...."
Ishaq panicked and looked at me.
I looked at the devil and said,
"I'm going to kill you. Touch these people and they'll kill you."
[Man] How dare you make me.]
The demon lands arrogantly on the ground. I was flawed and forced to rise.
"I'm going to kill you a hundred times when I'm dead. Even if you go out of your mind and cry like an animal, you, you...!"
Cookook smiles, the demon raises his eyebrows.
[That's funny, kid. Your curse is sweeter to me than any music. Now, what do you want to kill and moan more in anger?]
A slow look around the family looked at my father holding my shoulder with his knees bent.
[You have desperate eyes. Would you be in pain if you killed him?]
When I blew it, the demon laughed.
[This is also the most precious one. Huh?]
I stood in the way of the devil and pleaded.
"I was wrong. I was wrong! I'll do whatever it takes. I'll do whatever you say. Don't kill me, please."
My family looked at me in a panic, and my dad looked at me quietly, crying and begging.
"What's in there?"
[You're a sensible human being. No, faith.]
It was when the devil pointed his sharp nails at his father's neck.
Something flashed from my hand.
That's it!
The seal of the Long Range Movement came to mind and the amendment that the Chairman was keeping was delivered into my hands.
I quickly heard the amendment.
[That...!]
This time it was the devil, not me.
"Didn't you think I'd just sit there and wait for you to get hurt? '
I sent a signal to the Chairman before he fell and waited for him to send me an amendment!
Of course, if I summon the Devil of Amethyst, now that I have exhausted my divine power to stop the Devil, my life would be in danger.
But I know it from my experience at Bourne.
Demons recognize the 'passage of the devil'.
The tears of the goddess that Bune wanted were probably the passage of the devil. He went back and said, "Finally, I found my master……." I'm impressed.
Amethyst was powerful enough to speak to me. It is clear that what is in this is a powerful demon.
It can be a degree of blackmail.
[Stupid thing. I can read your thoughts...!]
'Then you know. If you don't back down, I'm willing to sacrifice my life to summon the Devil of Amethyst.'
The demon kicked his teeth, his tongue.
But as I tightened the amendment, the demon retreated once again, flattering.
Then, with wings similar to those of an eagle, he emerged again into the air. And he disappeared.
I stumbled and sat down terribly before he disappeared.
'Lord, I thought you were going to die.....'
When the tension is relieved, the pain is pushed.
I didn't know he was so vigilant that he broke his head when he hit the wall. The temples grew weary.
"Dad....."
It was a muttering moment.
The court wizards and the central knights rush to the palace shield with a feeling of anomaly.
Grab it!
A central knight's sword aims at me with a sharp friction sound.
There was a starter in the back of the court wizard's hand.
"What are you doing? Get rid of it now!"
Ishaq shouted, but the Black Knights of the Central Knights were still facing me.
I was a magical sinner in the Imperial Empire.
* * *
That Duke of Valois.
When I heard the news from the deputy, a smile came to my mind.
With a loud laugh, he gently drops his drink on the table.
"Yeah, she got caught."
"We're desperately trying to save lives in Dublin, but it must be a crowd."
It would have been better if she had not died in front of Theodore's eyes, because she was trapped in Oxa.
The use of magic in the Imperial Palace was a felony worthy of treason.
There will be a rumor to tell the truth. A child cannot endure the ghost of the Central Knights, so either he dies or he makes a false confession.
"If you're good, you can get rid of all the Dublin Red pricks."
Duke Valois smiles joyfully and looks at Hayton Valois standing in the corner.
"Aren't you happy, son?"
"……."
"I'm asking."
"Yes?! Yes…… yes…… yes."
Hayton grabbed his less trembling hand with a white-faced face.
'Crazy..... Crazy!'
I had noticed what was happening underground since I was a child, but this was the first time I had actually seen it.
I followed him without even knowing it.
'My father is crazy.'
Calling out creatures, not handing them over, was a sin more than Dubled's daughter had committed.
Hayton was smarter than his peers.
In my father's words during the 'Fall Ceremony', this Fall Ceremony was unexpected.
But where did you prepare so many human offerings?
'If it's kidnapping or trafficking, my family..... I.....'
Hayton bites his dull, blue lips.
Nearby, Niels draws his brother with a frightened eye.
"Brother……."
"Shut up."
"But……."
Niels looks around with frightened eyes and whispers to Hayton.
"But where is your mother?"
"……."
"I said I've never been out, no matter how I look....."
[Honey……! Ahhh, William Valois! I will curse you! I will curse you..!!]
Hayton's face became increasingly dead.
* * *
I put my hand out the iron spear and said,
"Feed me."
"……."
"Feed me!"
Guards guarding Oxa stare at me with a grim face.
"You're the only sinner who eats three snacks at 3: 00."
"But my dad told me not to starve."
"……."
"My dad. My dad. Duke Dubled."
"I will bring you……."
Two days in Oxa.
I ate well and slept well.
The palace meal is delicious, and the duvet also gives a pretty chunky one. The pillows were fluffy, so I slept well.
'This is the honey of power.'
The Imperial Palace seems to be trying to file a procedural complaint, but I fell asleep crying as soon as I was tied to the chair.
[Grunts] Dad! Auntie! Brothers! Grandmother! Emperor! Ugh! That's the guy! Lord Rigel Coldern of the 4th Army of the Central Knights! Count Coldern's brother! Nomo's alive, he's got two kids! Your child's name...!!]
When I said this, the head of Gossip got bored and ran away.
Because of that, the person in charge of the complaint has already changed for the fourth time.
If I'm released, you can't just leave me in Dublin.
I looked out the slimy iron spear.
'Okay, no one.'
This is the time.
I quickly bribed the soldier and grabbed the blind spot I brought in.
'I was so surprised yesterday that I didn't look at it properly, so now again.....'
Then he poured out his divine power on the blind eye.
Bang!
Oxa shook.
After the wind blowing out of the oxa without a window, the same pillar of fire came to mind as in the time of Bune.
'What, you can do it!'
But why didn't you come yesterday?
[You finally called me. Nice to meet you. I'm the 25th pillar, Glasgow... You...!!]
The devil opened his mouth at the same time.
[You, you, you...!]
"Ha. This is why the passage is not open."
I stare at the devil in front of me.
The demon who attacked me and my family yesterday to tear me apart and kill me.
He was puzzled when he was embarrassed.
[Er, yesterday's work, too, huh? Well, that's what I mean. I can't help it because of the work... You know? Work?]
"I know. Would you like to sit on your knees?"
He's dead, you.
You'll Also Like
-
Where the noise did not reach
Chapter 162 5 hours ago -
The Fourth Calamity never believed in the steel torrent!
Chapter 329 5 hours ago -
The Chief Detective Inspector is dead. I'm now the top police officer in Hong Kong!
Chapter 163 5 hours ago -
Doomsday Sequence Convoy: I can upgrade supplies
Chapter 286 5 hours ago -
I was acting crazy in North America, and all the crazy people there took it seriously.
Chapter 236 5 hours ago -
My Taoist nun girlfriend is from the Republic of China era, 1942.
Chapter 195 5 hours ago -
Is this NPC even playable if it's not nerfed?
Chapter 218 5 hours ago -
Forty-nine rules of the end times
Chapter 1012 5 hours ago -
Super Fighting Tokyo
Chapter 286 5 hours ago -
LOL: I really didn't want to be a comedian!
Chapter 252 5 hours ago